Sunday, 19 November 2017

டெஸ்ட் டியூப்பில் இண்டர்நெட் - சுஜாதா தேசிகன்



 

நிக் கோல்ட்மேனுக்கு (கணிதவியலாளர் மற்றும் மரபணு விஞ்ஞானி) அமெரிக்காவிலிருந்து ‘ஃபெட் எக்ஸ்’ மூலம் கூரியர் ஒன்று வந்து சேருகிறது. சுண்டு விரல் அளவுக்கு ஒரு டெஸ்டியூப். ஆனால் காலியாக இருக்கிறது. ஏமாற்றத்துடன் தன் நண்பரிடம் சொல்ல, நண்பர் வெளிச்சத்தில் அதைப் பார்த்தார் கீழே துளி அளவு அழுக்கு மாதிரி ஒரு வஸ்துவைப் பார்த்து “சரியா பாருங்க கீழே ஒட்டிக்கொண்டு இருக்கு” என்றார்.

நிக் உடனே அந்தக் கடுகு சைஸ் அழுக்கைத் தண்ணீரில் கலந்து ஒரு இயந்திரத்துக்கு அனுப்பி அதில் என்ன இருக்கிறது என்று படிக்க ஆரம்பிக்கிறார். படித்து முடிக்க கொஞ்ச நேரம் ஆகும், அதுவரை சில விஷயங்களை உங்களுக்குச் சொல்கிறேன்.

உங்களிடம் முகம் பார்க்கும் கண்ணாடி இருக்கிறதா? அதில் உங்கள் முகத்தைப் பாருங்கள். சுமாராகத் தெரிந்தால் போதும், மேற்கொண்டு படிக்கலாம். என்ன தெரிகிறது? முகம், கண், மூக்கு, முடி... சரி இவை எல்லாம் உயிரணுக்கள் (cells)! நம் உடலில் கிட்டதட்ட பத்து டிரில்லியன் (1000000000000) உயிரணுக்கள் (cells) உள்ளன. தசைகள், குடல், முடி என்று கிட்டதட்ட 200 வகை உயிரணுக்கள் நம் உடலில் இருக்கின்றன. ஒவ்வொன்றும் ஒரு வகை.
மீண்டும் உங்கள் முகத்தைப் பாருங்கள். நீங்கள் பார்க்கும் கண் லென்ஸ் கூட ஒரு வகை உயிரணுதான்! உங்கள் விரல் நுனியில் 2-3 பில்லியன் செல்கள் இருக்கின்றன. செல்லின் அளவு, ஒற்றைத் தலைமயிரின் விட்டத்தில் (diameter) பத்தில் ஒரு பாகம் மட்டுமே.
எலும்பு உடைந்தால் மீண்டும் வளர்கிறது. பல் விழுந்தால் மீண்டும் முளைக்கிறது. ஆல மரத்தின் சின்ன விதையில் இலை, விழுது என எல்லாம் புரோகிராம் செய்யப்பட்டுள்ளன. எதில்? டி.என்.ஏ என்ற மரபணுவில்.

தனுஷின் உண்மையான பெற்றோர் யார்? தனுஷுக்கு டி.என்.ஏ பரிசோதனை!என்பது தினத்தந்தி செய்தியாகி, டி.என்.ஏ பழக்கபட்ட வார்த்தையாகிப் பல நாள் ஆகிவிட்டது. டி.என்.ஏ என்றால். சர்க்கஸில் நாம் பார்க்கும் முறுக்கிவிட்ட நூலேணி மாதிரி ஒரு பிம்பம் என்று இந்நேரம் உங்களுக்குத் தெரிந்திருக்கும். அந்த நூலேணி சமாசாரம்தான் உங்கள் உயிரணுவில் இருக்கிறது.
கொஞ்சம் டெக்கினிக்கலாகப் பார்த்தால் டி.என்.ஏ என்பது ‘டிஆக்சிரிபோநியூக்ளியிக் அமிலம்’ (deoxyribonucleic acid). பல வகை செல்கள் இருக்கின்றன என்று பார்த்தோம். நம் உடலின் அங்கங்கள் எப்படி உருவாக வேண்டும் என்ற தகவல்கள் எல்லாம் இந்த டி.என்.ஏவில்தான் பொதிந்திருக்கின்றன.

இந்த நூலேணிப் படிகளில் விதவிதமான புரோட்டீன்களை எப்படி உற்பத்தி செய்யவேண்டும் என்ற குறிப்பு இருக்கிறது. இந்த ரகசியத்தைத்தான் ஜீன் (Gene) என்கிறார்கள். முக அமைப்பு, நிறம் போன்ற தகவல்கள் எல்லாம் இந்த ஜீன்களில்தான் இருக்கின்றன. எல்லா மனிதர்களின் ஜீன்களும் 98-99% ஒரே மாதிரிதான் இருக்கும். மிச்சம் இருக்கும் 1-2%தான் என்னையும், இதைப் படிக்கும் உங்களையும் வேறுபடுத்துகிறது.
உங்கள் எச்சில், நகம், ரத்தம் என்று எல்லாவற்றிலும் டி.என்.ஏ இருக்கிறது. எல்லாம் உயிரணுதானே! கடித்துத் துப்பிய நகம் மீண்டும் வளர்வது, கொசு கடித்துச் சொறிந்த கீறல் ஆறுவது, அடுத்த வீட்டுப் புளிப்பு தோசை வாசனை, பாடல், நிறம் எல்லாம் இங்கேதான் பதிவு செய்யப்பட்டுள்ளன.

யார் இந்த ரகசியங்களை அதில் எழுதினார்கள்? கடவுள் என்று சொல்லலாம், தலை எழுத்து என்றும் சொல்லலாம்.

கடவுள்தான் டி.என்.ஏவில் ரகசியங்களை எழுத முடியுமா? பென் டிரைவில் எழுதிவைப்பது மாதிரி நாமும் அதில் எழுதிவைக்க முடியாதா? முடியும் என்கிறது விஞ்ஞானம்.
டி.என்.ஏவின் நூலேணியில் நாம் அடுத்த படிக்குச் செல்லாலாம். மரபணுவில் தகவல் பொதிந்திருக்கிறது என்று 1928ல் வழக்கம்போல எலியை வைத்துக் கண்டுபிடித்தார்கள். ஆனால் அப்போது டி.என்.ஏவின் கூட்டமைப்புப் பற்றிக் கண்டுபிடிக்கப்படவில்லை.
எலியை வைத்துச் சோதனை செய்யுமுன் இரண்டு விதமான பாக்டீரியாவை (நுண்ணுயிர்) உங்களுக்கு அறிமுகம் செய்கிறேன். ஒன்று S வகை, இன்னொன்று R வகை. S வகை ஸ்மூத்தாக இருக்கும், ஆனால் நிமோனியாவை ஏற்படுத்தும். R வகை கரடுமுரடாக இருக்கும். ஆனால் சாது என்று மட்டும் தெரிந்துகொள்ளுங்கள்.

எலிக்கு S வகையைச் செலுத்தினார்கள். நிமோனியா வந்து இறந்தது. எலிக்கு R வகையைச் செலுத்தினார்கள், ஒன்றும் ஆகவில்லை. S வகை நுண்ணுயிர்களை வெப்பமூட்டிக் கொன்றுவிட்டுப் பிறகு எலியில் செலுத்தினார்கள். எலிக்கு ஒன்றும் ஆகவில்லை. கடைசியாக R வகையைச் செலுத்தி, கூடவே வெப்பமூட்டிய S வகையையும் செலுத்தினார்கள். எலிகள் மீண்டும் மாண்டன.
வெப்பமூட்டி S வகை நுண்ணுயிர்கள் பொசுங்கினாலும் R வகையுடன் சேரும்போது மீண்டும் நிமோனியா நுண்ணுயிர்கள் உயிர்பெற்றன. அதாவது எங்கோ ஏதோ தகவல் ஒட்டியுள்ளது என்று கண்டுபிடித்தார்கள். 1940ல் அது டி.என்.ஏ என்று கண்டுபிடித்தார்கள்.


இந்தக் கட்டுரையை படிப்பது போல டி.என்.ஏவைப் படிப்பது சுலபம் இல்லை (பல நாள் ஆகும்; டி.என்.ஏ சரடைச் சேமிக்க நிறைய மெமரி வேறு வேண்டும்). உதாரணத்துக்கு டி.என்.ஏவைப் படித்தால் இப்படி இருக்கும் ATCATGCA... ஒவ்வொரு எழுத்தும் ஒரு கூட்டணுவைக் குறிக்கிறது - நியுக்ளியோ-டைடுகள் (nucleotides) அதாவது A-அடினைன், T-தயோமைன், C-சைடோசைன், G-குவானின் என்று பெயர்கள். இவை எல்லாம் புரதங்கள். ஜீன்கள் இவற்றை உண்டு பண்ணுகின்றன. இந்தப் புரதங்களின் வரிசைதான் நம் தலைவிதி. இதில்தான் தகவல் அடங்கியிருக்கிறது.

மனிதனாக இருந்தாலும், வெண்டைக்காயாக இருந்தாலும் டி.என்.ஏ ஒன்றுதான். டி.என்.ஏ தேவையான புரேட்டீன்களை உற்பத்தி செய்கிறது. என்ன விதமான புரோட்டீன் தேவை என்ற தகவல்கள் ஜீன்களில் இருக்கின்றன. அப்பா போன்ற கண்களும், அத்தை போன்ற குணங்களும் பரம்பரை பரம்பரையாக நம் மரபணுவில் ஹார்ட் டிஸ்க் போல் எங்கோ சேமித்து வைக்கப்பட்டுள்ள தகவல்களே!

நாம் சிடி, டிவிடி பென்டிரைவ், கையடக்க ஹார்டு டிஸ்க் போன்றவற்றில் சேமித்து வைத்துள்ள படம், பாடல்கள், வீடியோ, ஓசியில் கிடைத்த பிடிஎஃப் எல்லாம் நம் மரபணுவில் சேமிக்க முடிந்தால்? நகைச்சுவையாகப் பேச ஆரம்பித்து, சேமிக்க முடியும் என்று நம்பமுடியாத சாதனையைச் சாதித்துள்ளனர்.
நாம் தினசரி சாதாரணமாக உபயோகிக்கும் பென் டிரைவில் எப்படித் தகவல்கள் சேமிக்கப்படுகின்றன என்று சரியாக ஐந்து வரிகளில் சொல்கிறேன்.

பென் டிரைவ்களில் ஒரு சிறிய அச்சிடப்பட்ட சர்க்யூட் போர்டு இருக்கிறது. அதில் சிறிய ‘மைக்ரோசிப்’, தகவல்களைப் படிக்க, சேமிக்க உதவுகிறது. குறைந்த மின்சார சக்தி கொண்ட தகவல் சேமிப்பு EEPROM அடிப்படையிலானது. அதில் தகவல் எழுதவோ அழிக்கவோ முடியும். தகவல்கள் எல்லாம் ‘0’ அல்லது ‘1’ ஆகவோ சேமிக்கப்படுகின்றன. படமோ, பாடல்களோ உள்ளே எல்லாம் 0 அல்லது 1. இதை ‘பிட்’, ‘பைட்’ என்று நான்காம் வகுப்புக் குழந்தைகூடச் சொல்லிவிடும்.

நமது தகவல்களின் ‘பிட்’டை மரபணுவின் A, C, T, G பாஷையில் மாற்றி, தகவல்களைப் பிரதிபலிக்கும் மூலக்கூறை அமைக்க முடிந்தால்? கட்டுரை ஆரம்பத்தில் நிக் கோல்ட்மேன் நினைவிருக்கிறதா?

2011 பிப்ரவரி 16 அன்று ஜெர்மனியில் ஒரு ஹோட்டலில் நிக் கோல்ட்மேன் சக மரபணு ஆராய்ச்சியாளர்களுடன் பேசிக்கொண்டிருந்தார். “மரபணு சேமிக்க நிறைய மெமெரி தேவைப்படுகிறது, செலவும் அதிகமாகிறது” என்றார். அப்போது ஒருவர் “பேசாம மரபணு தகவல்களைச் சேமிக்க மரபணுவையே உபயோகிக்க வேண்டியதுதான்” என்று ஜோக்காக கமெண்ட் அடிக்க, ‘சபாஷ் நாயுடு’ போஸ்டரில் பல்ப் எரிவது போல ஐடியா உதயமாகி “ஏன் அப்படிச் செய்ய கூடாது” என்று டேபிளில் இருந்த ‘டிஷ்யூ’ பேப்பரில் அவர்கள் ஐடியாக்களை எழுத ஆரம்பித்தார்கள்.

இரண்டு வருடம் கழித்து தாங்கள் செய்த சோதனை வெற்றி என்றார்கள்!

என்ன செய்தார்கள்? சொல்கிறேன். ஷேக்‌ஸ்பியர் நாடகத்தின் ஒரு பகுதி, புகழ்பெற்ற மார்ட்டின் லூதர் கிங்கின் சில நிமிடப் பேச்சின் MP3 வடிவம், முதல் டின்.என்.ஏ பற்றிய ஆராய்ச்சிக் கட்டுரை, அவர்களது ஆராய்ச்சிக் கூடத்தின் படம், இவர்கள் செய்யும் ஆராய்ச்சி பற்றிய கட்டுரை என்ற ஐந்தையும் டி.என்.ஏ குறியீடாக மாற்றினார்கள். “Thou art more lovely and more temperate” என்ற சேக்‌ஷ்பியர் வரியை டி.என்.ஏ குறியீடாக “TAGATGTGTACAGACTACGC” மாற்றி இதை இணையம் வழியாக அமெரிக்காவிற்கு அனுப்பினார்கள். அவர்கள் அதைச் செயற்கை முறையில் தயாரிக்கப்பட்ட (Synthetic DNA) மரபணுவில் குறியீடாகச் செலுத்தி (கலர் பிரிண்டர் மாதிரி இந்த டி.என்.ஏவை அச்சடிப்பார்கள் என்று வைத்துக்கொள்ளுங்கள்) டெஸ்டியூபில் பேக் செய்து அனுப்பினார்கள். கட்டுரையின் ஆரம்பத்தை மீண்டும் ஒருமுறை படியுங்கள். டெஸ்டியூபின் கீழே ஒட்டிக்கொண்டு இருந்த அந்தத் துளியூண்டைத் தண்ணீரில் கலந்து அதைப் படித்தபோது அவர்கள் அனுப்பிய ஷேக்‌ஸ்பியர் வரிகள், எம்.பி3 பேச்சு, கட்டுரை, படம் எல்லாம் அச்சு அசலாக அப்படியே ‘மீண்டும்’ கிடைத்தது டி.என்.ஏ வழியாக!

டெஸ்டியூப் உள்ளே ஒட்டிக்கொணடிருந்தது கடுகு சைஸில் இவ்வளவு. இதையே டெஸ்ட்யூப் முழுக்க இருந்தால் அதில் பொதிந்துள்ள விஷயம் கிட்டத்தட்ட பத்து லட்சம் சி.டிக்களில் அடங்கும் தகவல்களாக இருக்கும்.

உலகத்தில் உள்ள தகவல்களை எல்லாம் ஒரு கார் டிக்கியில் அடக்கிவிடலாம்! டி.என்.ஏ படிக்க முன்பு பெரிய இயந்திரங்கள் தேவைப்பட்டன. ஆனால் இன்று வீட்டில் ரத்தத்தில் சக்கரை பரிசோதிக்கும் மீட்டர் போல ஒன்றை வைத்து சில மணி நேரத்தில் படித்துவிடலாம். மரபணுவை அச்சடிப்பதற்கு மட்டும் நிறைய செலவு ஆகிறது, இன்னும் கொஞ்ச நாளில் அதையும் குறைத்துவிடுவார்கள்.

பென் டிரவ் போய் தம்ப் (Thumb) டிரைவ் உங்கள் பேரன் காலத்தில் வந்துவிடும். கட்டை விரலை கம்யூட்டர் யூ.எஸ்.பி ஓட்டையில் நுழைத்தால் பாகுபலி படம் பார்க்கலாம்.

சிடி, பென் டிரைவில் தகவல் சில வருடங்களே இருக்கும். ஆனால் டி.என்.ஏ பல ஆயிரம் வருடங்கள் இருக்கும். குளிர் பிரதேசம், வெளிச்சம் இல்லை என்றால் பல லட்சம் வருடங்கள் கூட இருக்கும். இன்றும் மம்மிகள் கண்டுபிடித்து எடுக்கும்போது அதில் டி.என்.ஏ அழியாமல் இருக்கிறது. அண்டார்ட்டிகாவில் பனியில் உறைந்த பல விங்குகளில் பொதிந்துள்ள டி.என்.ஏவை விஞ்ஞானிகளால் படிக்க முடிகிறது. ‘டி.என்.ஏ’ பென் டிரைவ் வந்துவிட்டால் வழக்கம்போல் தகவல் சேமித்து அதை ஃபிரிட்ஜில் வைத்தால் போதும், ஜன்மத்துக்கும் அழியாது.
செயற்கை மரபணுவில் சேமிக்கலாம், உயிருள்ள டி.என்.ஏவில் சேமிக்க முடியுமா? டி.என்.ஏவை உயிருள்ள அணுக்களில் செலுத்தி அதிலும் வெற்றி கண்டுள்ளார்கள். ஏன் டி.ன்.எவை வைத்து ஆபரேட்டிங் சிஸ்டம், கிளவுட் கம்ப்யூட்டிங், வைரஸ் கூடத் தயாரித்துவிட்டார்கள் என்பதையெல்லாம் இன்னொரு தனி கட்டுரையாக எழுதலாம்.

நிக் கோல்ட்மேன் டிவிட்டரில் இருக்கிறார். இந்தக் கட்டுரையை எழுதும்போது அவரை வெறும் 1,114 பேர் பின்தொடர்கிறார்கள். உலக நாயகன் கமலை 1.77 மில்லியன் பேர் பின்தொடர்கிறார்கள்.

கோமாளிகளின் டி.என்.ஏ!

******* 

No comments:

Post a Comment

அநாகரீகமான பின்னூட்டங்கள் வெளியிடப்படமாட்டாது.